Руководство по генетике

Geneticist.png
 
Рут МакВорк говорит:
"Добро пожаловать в генетику, брат! Вы чувствуешь себя хорошо? Ты ДОЛЖЕН чувствовать себя хорошо! Теперь ты подобен крошечному богу! Готов ли ты стать тем, кем был рожден? Готовы ли ты спасти станцию (или полностью ее испортить)?

Выше нос, приятель. Это не так уж и сложно. Но прежде чем ты начнешь хватать обезьян из загона, ты должен знать основы."


Департамент

Genetics.png

Добро пожаловать в генетику.

Эта комната оснащена двумя DNA Scanner(ДНК сканер) и двумя DNA Scanner Access Консолями, вместе с коробками для дисков и другими принадлежностями. Диски очень полезны, как мы увидим позже.

В соседней изолированной комнате находятся ваши подопытные. Эти обезьяны станут вашими подопытными кроликами. Вы будете ставить на них эксперименты и заставлять их страдать. Это довольно бесчеловечно. Но такова жизнь, и через некоторое время все это будет стоить того.

Scanner.gifMedcom.gif Модификация ДНК

This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the Research Director

.

Теперь давайте познакомимся с консолью доступа к сканеру ДНК. В ней есть несколько важных моментов. Для начала вам нужно выучить несколько терминов:

Unique Enzymes

  • Unique Enzymes (UE) = Ваше имя. Даже если вы мутируете UE, это никак не повлияет на имя. Однако что вы можете сделать, так это передать UE от одного человека к другому, скопировав его имя.

Unique Identifiers

  • Unique Identifiers (UI) = Ваши косметические детали - цвет глаз, цвет кожи, стиль прически, цвет прически и пол.

В консоли доступа к сканеру ДНК есть вкладка с названием "Enzymes". Эту вкладку можно использовать для копирования UE и UI между людьми.

  • Нажмите "Save" Чтобы сохранить UE + UI в консоли. Вы не можете сохранять мутации таким образом (больше).
  • Нажмите "Transfer" чтобы скопировать гены буфера тому, кто находится внутри сканера. Вы можете выбрать между Enzymes (UE), Identity (UI) и Full Makeup (UE+UI).
  • Нажмите "Transfer (Delayed)" чтобы скопировать гены буфера следующему человеку, который зайдет в сканер и закроется там (например, вы сами). Эта опция доступна только в том случае, если сканер пуст.
  • Нажмите "Print" для печати ДНК-инжектора, содержащего гены из сохраненного буфера. Введя его человеку, вы передадите ему UE, UI или UE+UI. Однако, в отличие от инъекторов мутаций, эти инъекторы ДНК не являются постоянными и действуют лишь некоторое время после введения.

Structural Enzymes

  • Structural Enzymes (SE) / Genetic Sequence = Ваши мутации. Они содержат данные о вашей генетической структуре. Это определяет вашу расу и мутации. Термин «Structural Enzymes» больше не используется в консоли доступа к сканеру ДНК, поскольку он был заменен на «Genetic Sequence» (что одно и то же), но этот термин все еще может встречаться в других местах.

Genetic Sequencer

Так может выглядеть вкладка Sequencer, когда в сканере находится человек.

В DNA scanner access console есть вкладка "Sequencer". Тут вы изменяете гены чтобы найти мутации. Здесь вы будете изменять гены, чтобы найти мутации. Существует четыре типа блоков: A, T, C и G. Каждая пара букв в этих блоках соединена. A соединяется с T, и G соединяется с C. Порядок не имеет значения. В каждой паре есть правильная комбинация "AT, TG, CG или GC" которую нужно заполнить. Если вы видите немодифицированную пару X-T то это значит, что правильная комбинация будет A-T. Когда все 16 пар будут иметь правильные блоки, мутация активируется и откроется у вас в консоли, тем самым вы сможете сохранить ее. У мартышек может быть только мутация monkified пока они не очеловечены. Как только вы нашли название мутации, эта мутация может быть идентифицирована в DNA scanner access consoles.

Возможно, вы захотите отключить мутацию обезьяны, заменив одну из здоровых пар на другую букву. Как это сделать, подробно описано руководстве ниже.

Gene scanner.gif Genetic Sequence Scanner

Как это выглядит после щелчка на ком-то с помощью элемента «Genetic Sequence Scanner», а затем с помощью Genetic Sequence Scanner в руках и выбора «Mutation 39». Обратите внимание, что теперь мы знаем, что первая пара должна быть C-G.

В более сложных мутациях будет много неизвестных пар (X-X). Вы не можете просто случайно ввести A-T, поскольку это предопределено, что должно быть. Зная все это, вы можете воспользоваться сканером генетических последовательностей (Genetic Sequence Scanner).Gene scanner.gif который находится раундстартом в вашем кармане. Если вы ищете правильные пары с мутацией 39, сканируйте людей, пока не найдете человека с мутацией 39. Затем используйте сканер в руке, чтобы появилось меню. В меню выберите «мутация 39». Это даст вам показания, которые, вероятно, дадут вам больше информации о том, какие пары вам нужны для завершения мутации 39.

Как это выглядит после правильного заполнения всех пар. Мутация 39 оказалась monkified. Поскольку разгадка мутации активирует ее, субъект в сканере теперь обезьяна.


Вы можете использовать Genetic Sequence Scanner Gene scanner.gif на DNA scanner access console на консоли доступа к сканеру ДНК, чтобы навсегда синхронизировать предмет, что позволит вам видеть названия обнаруженных мутаций при сканировании людей с его помощью.

Более подробную информацию о некоторых других вкладках можно найти в разделе далее.

Hulk.png Список мутаций

Прежде чем мы приступим к синтезу, вы должны знать, какие чудовищные вещи можно сделать с человеком. Обычно недостижимые мутации выделены красным шрифтом.

Mutation Name Description Indicators Message How/Where to Obtain Instability
Telekinesis "Странная мутация, позволяющая владельцу взаимодействовать с предметами с помощью мысли."

Эта сила позволяет субъекту управлять предметами с помощью своего разума, находясь на большом расстоянии! Это самая востребованная сила, поскольку она позволяет совершать невероятные поступки и делает сильного робаста почти бессмертным. Чтобы использовать ее, переключитесь на пустую руку и нажмите на предмет (обратите внимание, что, если вы можете, ваш персонаж/игра будут отдавать предпочтение обычному взятию предмета, а не телекинетическому). Под предметом и в вашей руке появится символ круга, и теперь вы можете управлять предметом. Вы также можете использовать любую консоль на расстоянии.

Появляется в виде голубого свечения вокруг головы субъекта. "You feel smarter" Генетика / Punished God sect 30
Hulk "Малоизученный геном, который заставляет мышцы обладателя расширяться, затрудняет речь и вызывает позеленение кожи."

Субъект становится чрезвычайно сильным, что позволяет пробивать укрепленные стены и не может говорить без крика. Объект также невосприимчив к оглушению и замедлению от выносливости и обычного урона, и его нельзя пробить. Разрушение стен и механизмов наносит сильный физический урон руке. Эта мутация пропадает, когда здоровье субъекта падает до критического уровня.

  • Может раскручивать людей за хвосты. Чтобы сделать это, схватите жертву в третий захват, включите режим броска и нажмите в направлении, в котором хотите бросить.
  • Делает вас очень уязвимым к холоду и наносит физический урон от него.
  • Запрещает вам использовать оружие из за ваших больших пальцев
Субъект становится зеленым и с красными глазами. "Your muscles hurt." Radioactive + Strength 40
Temperature Adaptation "Странная мутация, делающая носителя невосприимчивым к повреждениям от экстремальных температур, как горячих, так и холодных. Не защищает от вакуума [или областей высокого давления].."

Эта мутация является взаимоисключающей с Pressure Adaptation.

Объект имеет пульсирующую оранжевую «ауру». "Your body feels warm." Генетика 25
Pressure Adaptation "Странная мутация, делающая носителя невосприимчивым к повреждениям, наносимым средами низкого и высокого давления. Не защищает от температуры, включая холод космоса [или сверхгорячего газа].."

Эта мутация является взаимоисключающей с Temperature Adaptation.

Объект имеет пульсирующую голубую «ауру». "Your body feels numb." Генетика 25
Thermal Vision "Пользователь этого генома может визуально воспринимать уникальную тепловую подпись человека."

Субъект может видеть людей даже сквозь стены и в темноте. Наносит 10 повреждений глазам при использовании и длится около 10 секунд.

\ "You can see the heat rising off of your skin..." Генетика 25
Chameleon Субъект становится способным тонко изменять характер света, чтобы стать невидимым, пока он остается неподвижным. Субъект начинает сливаться с окружением. "You feel one with your surroundings." Генетика 25
Dwarfism Превращает субъекта в гнома, делая его необычайно коротким по сравнению с остальными членами команды. Карлики могут проходить над столами,не получая штраф.

Взаимоисключающая мутация с Gigantism

Субъект выглядит меньше. "Everything around you seems to grow.." Человеческая раса 5
Near Sightness "У обладателя этой мутации плохое зрение."

Экран субъекта становится мутным примерно на половину вашего зрения. Это не так уж и плохо, и может быть временно исправлено с помощью рецептурных очков.

\ "You can't see very well." Генетика
Epilepsy Субъект начинает падать и все время трясется. Субъект страдает от припадков. "You get a headache." Генетика
Coughing Заставляет субъекта ронять мелкие предметы, которые он держит в руках, например шприцы. Довольно безобидно, но потенциально может быть крайне раздражающим. Субъект кашляет "You start coughing." Генетика
Tourette's Syndrome Субъект постоянно ругается. Также может наступить паралич. Субъект громко ругается и дергается. "You twitch." Генетика
Nervousness Заставляет субъекта заикаться. В лучшем случае раздражает. Субъект заикается при разговоре. "You feel nervous." Генетика
Blindness Субъект полностью слепнет, становясь частью обычно забытого меньшинства. Как печально. Глаза субъекта не реагируют на свет. "You can't seem to see anything." Генетика
Deafness Делает субъекта глухим. В лучшем случае безвредно, в худшем - раздражает. Вы просто ничего не слышите, даже себя. \ "You can't seem to hear anything..." Генетика
Illiterate Субъект становится неграмотным, что мешает ему пользоваться бумагой, ручками, компьютерами и некоторой электроникой, требующей чтения. \ "You feel unable to read or write." Генетика
Clumsiness Подавляет определенные функции мозга, вызывая у субъекта клоунскую неуклюжесть. Для тех, кто всегда хотел быть клоуном. Из-за этого субъект случайно роняет предметы, которые держит в руках, не может использовать станбатоны, наручники, выстрел из пистолета скорее всего ранит субъекта и т. д. \ "You feel lightheaded." Генетика/Клоун
Unintelligible Сильно повреждает часть мозга, отвечающую за формирование предложений, в результате чего субъект может говорить только короткими фразами. \ "You can't seem to form any coherent thoughts!" Генетика
Mute Полностью отключает центр речи в мозгу субъекта. \ "You feel unable to express yourself at all." Генетика / Punished God sect
Wacky Заставляет субъекта говорить в странной манере. Заставляет вашу речь в чате использовать шрифт Comic Sans, который обычно можно увидеть только в мегафоне клоуна. \ "You feel an off sensation in your voicebox." Генетика
Glowy Придает субъекту слабое свечение случайного цвета.

Взаимоисключающие с Anti-Glow

Субъект светится. "Your skin begins to glow softly." Генетика 5
Anti-Glow Заставляет субъект поглощать свет в радиусе вокруг себя.

Взаимоисключающие с Glow; работает с этериалами

Субъект обладает аурой тьмы. Излучает кольцо белого света в светоизлучающих расах. "Your skin seems to attract and absorb nearby light creating 'darkness' around you." Glowy + Void Magnet 5
Strength "Мышцы пользователя слегка расширяются."

Субъект чувствует себя сильнее, но это не так. Соедините с Радиоактивным, чтобы получить силу Халка.

\ "You feel stronger" Генетика
Fiery Sweat Субъект "потеет жидким огнем" и случайным образом сгорает, но становится более устойчивым к огню. Тесты показали, что субъектам требуется в два раза больше времени, чтобы полностью сгореть (модификатор x0.5 на ожоги). Стабильность снижает вероятность возгорания. Субъект самовозгорается "You feel hot." Генетика
Void Magnet "Редкий геном, притягивающий странные силы, которые обычно не наблюдаются."

У вас есть возможность на короткое время сделать себя неуязвимым, но при этом вы не можете двигаться. Вы также будете входить в это состояние случайно и против своей воли, но генетическая стабильность снижает частоту этого.

Субъект периодически заменяется дырой в реальности, имеющей форму субъекта. "You feel a heavy, dull force just beyond the walls watching you." Генетика 30
Radioactive "Мутация, которая заставляет носителя испускать смертоносное бета-излучение. Это влияет как на носителей, так и на их окружение."

Один из немногих источников излучения после изменений в радиационной модернизации.

Субъект светится зеленой аурой "You feel it in your bones" Генетика 5
Telepathy Мутация, позволяющая пользователю телепатически общаться с другими людьми. Субъект способен транслировать свои мысли непосредственно другим людям. "You hear your thoughts echo in your mind" Генетика / Punished God sect 10
Fire Breath Древняя мутация, которая наделяет ящериц огненным дыханием.

Позволяет стрелять взрывными огненными шарами, чем горячее шар, тем меньше он пролетит.

Субъект обретает способность дышать концентрированными огненными шарами. "You feel a heat built up in your throat" Раса ящеров 30
Chav Заставляет языковой центр мозга субъекта строить предложения в более примитивной манере. \ "Ye feel like a reet prat like, innit?" Генетика
Swedish "Ужасная мутация родом из далекого прошлого. Считается уничтоженной после инцидента в 2037 году.."

Заставляет языковой центр мозга субъекта строить предложения в неясной нордической манере.

\ "You feel Swedish, however that works." Генетика
Medieval "Ужасная мутация, происходящая из далекого прошлого, которая, как считается, когда-то была обычным геном во всей Европе старого света."

Заставляет языковой центр и первичную моторную кору мозга субъекта говорить и действовать, как рыцарь в поисках Святого Грааля.

\ "You feel like seeking the holy grail!." Генетика
Pig Latin "Историки утверждают, что еще в 2020-х годах человечество говорило исключительно на этом мистическом языке.."

Уменьшает количество скиллчипов для субъекта, с которыми он может работать

\ "Omethingsay eelsfay offyay." Генетика 5
Insulated Это делает вас устойчивым к ударам тока, что совсем не похоже на ношение резиновых перчаток, но без отрицательных сторон. Субъект не проводит электричество. "Your fingertips go numb." Генетика 25
Shock Touch "Обладатели этой способности могут проводить избыток электричества через руки, не поражая себя, что позволяет им поражать других."

Это дает вам неантагонистическую Mansus Grasp, которая бьет людей током, нанося урон от ожогов и вызывая сильное дрожание и замешательство. Не защищает субъекта от ударов.

Субъект может ударить током других людей голыми руками. "You feel power flow through your hands." Insulated + Radioactive 30
Transcendent Olfaction "Ваше обоняние сравнимо с собачьим."

Эта способность позволяет отслеживать людей по запаху. Возьмите что-нибудь в руку и с помощью силы найдите на нем запах. Если использовать силу, не держа ничего в руках, вы будете отслеживать запах, который нашли ранее. Полезно для детектива.

\ "Smells begin to make more sense..." Генетика 30
Geladikinesis Позволяет концентрировать влагу из воздуха в снег Эта мутация позволяет создавать снег, который используется для строительства снежных плит, стен, шаров и снеговиков. "Your hand feels cold" Генетика 10
Cryokinesis Извлекает отрицательную энергию из отрицательной пустоты, чтобы стрелять замораживающими лучами. Позволяет стрелять криокинезом, чтобы замораживать людей, предметы и плитки. "Your hand feels cold" Генетика 20
Antenna У испытуемого прорастает антенна. Это, как известно, позволяет им получать пассивный доступ к распространенным радиоканалам. Антенна находится на голове пользователя, и по сути это встроенная радиостанция. "You feel an antenna sprout from your forehead." Генетика 5
Mind Reader Испытуемый может заглянуть в недавние воспоминания других людей.

Они могут читать мысли других людей. Это позволит узнать имя объекта и некоторые фрагменты того, что он говорил в прошлом. Известно, что оловянная фольга блокирует эту способность.

На голове пользователя появляется антенна, и читающий может почувствовать, как в его сознание проникает что-то странное. "You hear distant voices at the corners of your mind." Antenna + Paranoia / Punished God sect 40
Spatial Instability Жертва мутации имеет очень слабую связь с пространственной реальностью и может быть смещена. Часто вызывает сильную тошноту. Субъект случайным образом телепортируется на небольшое расстояние и имеет склонность увеличивать нагрузку на уборщика. "The space around you twists sickeningly." Генетика 10
Paranoia "Субъект легко пугается и может страдать от галлюцинаций." Субъект часто кричит "You feel screams echo through your mind..." Генетика
Gigantism Клетки внутри субъекта раздвигаются и занимают большую площадь, отчего кажутся крупнее.

Взаимоисключающее с Дворфизмом

Субъект немного больше, чем обычно "Everything around you seems to shrink.." Генетика
Two Left Feet "Мутация, при которой правая нога заменяется левой. Симптомы включают поцелуй пола при шаге." Субъект случайным образом сбивается с ног. "Your right foot feels... left." Генетика
Tongue Spike Позволяет существу добровольно высунуть язык и использовать его в качестве смертельного оружия.

Язык не отрастает и остается в человеке до тех пор, пока его не удалят.

Субъект может стрелять языком. "Your feel like you can throw your voice." Генетика 15
Stimmed Химический баланс пользователя становится более прочным. (Ничего не делает.) \ "You feel stimmed." Генетика
Chem Spike Позволяет существу добровольно высунуть язык в виде биомассы, что позволяет передавать химические вещества на большое расстояние.

Язык не отрастает, а остается встроенным в человека до тех пор, пока его не удалят. Пока он внедрен, он позволяет вам перевести химическое вещество из вашего тела в тело цели, один раз. Это гораздо менее опасно, чем «Tongue Spike» сам по себе.

Субъект может выстрелить своим языком и ввести вам химические вещества. "Your feel like you can really connect with people by throwing your voice." Tongue Spike + Stimmed 15
Webbing Production Позволяет прокладывать паутину и перемещаться по ней.

Субъект может психологически привязаться к укладке паутины, если использовать его достаточно часто.

Субъект укладывает паутину или может двигаться сквозь нее без замедления. "Your skin feels webby." Генетика 15
Internal Martyrdom "Мутация, из-за которой тело разрушается в момент смерти. Не наносит вреда окружающим, но очень, очень дезориентирует."

Вредно для глаз свидетелей. Парализует также силиконов.

Субъект взрывается кровавым душем, когда находится в хардкрите. "You get an intense feeling of heartburn." Strong + Stimmed
H.A.R.S. Мутация, из-за которой организм отторгает голову. Расшифровывается как Head Allergic Rejection Syndrome или синдром аллергического отторжения головы. Предупреждение: Удаление этой мутации очень опасно, хотя она и восстанавливает органы головы. Субъект теряет голову, включая глаза, уши, язык и т.д. "Something feels off." Генетика
Acidic Flesh "У субъекта под кожей накапливаются кислотные химические вещества. Это часто приводит к летальному исходу."

В итоге эти скопления превращаются в кислотные кожные высыпания, обжигающие субъекта. Кислотостойкая одежда защищает субъекта от таких высыпаний..

Кожа субъекта часто пузырится и шипит, обжигая его. "A horrible burning sensation envelops you as your flesh turns to acid." Генетика
Spastic "Субъект страдает от мышечных спазмов."

Субъект может непреднамеренно задеть находящихся рядом людей и технику, а также нанести себе вред.

У субъекта часто бывают спазмы. "You flinch." Генетика
Monkified "Странный геном, считающийся тем, что отличает обезьян от людей."

Превращает субъекта в обезьяну. Врожденная мутация у людей и обезьян.

У субъекта часто бывают спазмы. "You feel unusually monkey-like." Генетика
Autotomy "Позволяет существу добровольно выбросить случайный придаток." Субъект способен отбросити конечности без хирургического вмешательства. "Your joints feel loose." Генетика 30
Biotech Compatibility "Субъект более совместим с биотехнологиями, такими как скиллчипы."

Дает возможность субъекту использовать больше скиллчипов

\ Нет сообщения Генетика 5
Clever "Заставляет субъекта почувствовать себя немного умнее. Наиболее эффективен для образцов с низким уровнем интеллекта."

Позволяет некоторым мобам, например обезьянам, выполнять такие сложные действия, как хирургические операции, пользоваться компьютерами и КПК, и многое другое.

\ "You feel a little bit smarter." Генетика 20
Stoner "Распространенная мутация, сильно снижающая интеллект."

Предоставляет язык Beach Bum, отменяет все остальные.

\ "You feel...totally chill, man!" Спавн на пляже

Chaplain Religion exclusives

Mutations granted by some of the Chaplain's religions. Their instability is set at 0.

"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."

Name Description Message
Honorbound "The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."

Disallows the subject to attack people unless they are attacked first.

"You feel honorbound!"
Burdened "The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."

Grants Telepathy and Mute, then Telekinesis and Mind Reader as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...).

"You feel burdened!"

Admin-spawn only mutations

Name Description Indicators Message Instability
X-Ray Vision "A strange genome that allows the user to see between the spaces of walls."

Basically it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination. Essentially replaced by the X-Ray implant.

Subject's eyes "glow eerily" if looked at with a penlight. "The walls suddenly disappear." 35
Laser Eyes "Reflects concentrated light back from the eyes."

Enables to shoot laser beams (dmg 20).

[to confirm] Subject's eyes glow "You feel pressure building up behind your eyes."
Elvis Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. A terrifying mutation named after its 'patient-zero'. "You feel pretty good, honeydoll."
Unstable DNA Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one. Strange mutation that causes the holder to randomly mutate. "You feel strange."

Guide to finding and using mutations

This guide here shows you step by step how to find the powers from the mysterious blocks!

First Steps

This guide will start with using a monkey, because they're in the pen for a reason.

  • Start by taking a monkey from the pen.
  • Shove it into a DNA Scanner next to the pen, by click dragging.
  • Check the console next to it, you'll see a bunch of options. Find Genetic Sequencer.

All mutations are randomized every round.

Humanizing a Monkey

Always humanize your monkey first, or their powers wont work or be savable.

  1. You and your geneticist buddy automatically share the mutations you've discovered, so work together to discover them all. Saved mutations have to be manually shared between computers using DNA Data Disks.
  2. Click through the mutations and find Monkified. Then break a random pair by changing a letter to X with CTRL+Left Click.
  3. When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
  4. If for any reason you got yourself some bad mutations and have no one to remove them, grab the mutadone pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of mutadone into it and take a sip. It should instantly clear all your mutations.
  5. Mutadone will also clear the monkified mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved mutadone into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.

Manifesting Mutations

Back to business! Now we'll try to make a mutation show itself to us:

  1. Find a mutation that has broken pairs.
  2. Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T.
    • The left click increments from A to G (A>T>C>G>A) — the right click, the other way around.
  3. You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
  4. If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described above) by scanning the other monkeys, yourself, or random crew members, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—20 minutes on unupgraded scanners).
  5. If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or scramble their DNA.

Scramble DNA

Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has. This also inflicts a large amount of genetic damage at once.

DNA Injector.png Activators and Mutators

After manifesting a mutation in the Genetic Sequencer tab, hit store to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab.

  • Activators: An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a Genetic Sequence Scanner Gene scanner.gif. For example, since all humans have the monkified mutation dormant in them, a monkified activator will always work on humans. Using an activator will not increase genetic instability. Used activators can be recycled into the DNA scanner access console to produce chromosomes.
  • Mutators: A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's instability (causes several bad effects if it reaches 100%). The mutation and its instability may then be removed by taking Mutadone.


The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. Activators have a much shorter cooldown.

DNA Injector.png Advanced Injectors

This is the "Adv. Injectors" tab.

After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following:

  1. Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
  2. Go to the Sequencer tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
  3. Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
  4. Go back to the "Adv. Injectors". Click Print. You will print an injector with named "Advanced (name) injector".

Genetic Instability

When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to 99 genetic instability before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable, and draws from one of two lists of effects, ranging from 'Mostly Harmless' to 'Dead and Unrevivable'. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.

Chromosome 21

Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console.

Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the Sequencer tab. Then click an activated mutation, or find one if none is active yet. You should see the line Select a chromosome followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back.

After you have added a chromosome to a mutation, you can store it to the Storage - mutations tab as normal (by clicking Save to console in the Sequencer tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome. The stored entry will retain its applied chromosome if saved to a Genetics data disk and transferred to a different DNA Scanner console.

These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):

  • Synchronizer (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%.
  • Stabilizer (1/16): The rarest chromosome. Reduces instability gained from the mutation by 20%.
  • Power (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
  • Energetic (5/16): Reduces cooldown on action based mutations.
  • Reinforcement (3/19): Makes the mutation immune to mutadone. Removed Aug 2020.

Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.

What to do with your powers

  • Export your best powers to a disk, as a backup. There's always the risk of an AI or someone else deleting them for any reason.
  • Make injectors to give to the greytide the heads of staff, the security, or the Engineers. You can also sell them for money!
  • Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
  • Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.

Healing your subjects and yourself

During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably H.A.R.S. and Radioactive. If unlucky, you may also be hurt. For that, there are several solutions:

  • The Roboticist can build medibots. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively.
  • The Chemists can provide you specific medicines, including Potassium Iodide for radiations (and toxins in irradiated carbons), Pentetic Acid for toxins and rads, and several others for burns, brute, or whatever else you may need.

Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found.


CRISPR Editing

This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from instability

Getting a CRISPR Charge

First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.

  • Get the Viro to make a virus with either Dormant DNA Activator or Viral Evolutionary Acceleration (Ideally otherwise benign)
  • Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
  • Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
  • Feed the used activator to the console to add the charge to the console


Using a CRISPR Charge

You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:

  • Solve the mutation you want or just use a mutator on a humanized monkey
  • Take note of the top row
  • On the subject you want to swap mutations on, solve the mutation you want to swap
  • Use a CRISPR charge on it
  • Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
Building the CRISPR String

For example, let's say Epilepsy is

  • A T T A C G C G A T T A C G C G
  • T A A T G C G C T A A T G C G C

And Telekinesis is

  • A T A T C C G G A T T A C C G G
  • T A T A G G C C T A A T G G C C

Take note of the first row of both

  • Epilepsy is A T T A C G C G A T T A C G C G
  • Telekinesis is A T A T C C G G A T T A C C G G

You then need to weave these rows together, old-new-old-new-old-new like this:

  • _A T A T C C G G A T T A C C G G :NEW (Telekinesis)
  • AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String
  • A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)

Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps Epilepsy out for Telekinesis.

  • AATTTAATCCGCCGGGAATTTTAACCGCCGGG

If your string is not the right length, nothing happens, but if the string is wrong, you may end up with Acid Flesh instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.

Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.



Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist.

DNA Infusion

Just settling with regular-old mutations not enough? Feel a need to TRANSCEND your human form? Maybe a little too into those weird Japanese cartoons? The brand new DNA infuser located genetics lets you become part BEAST, through... science! All you have to do is stick a corpse of a viable (or not) animal in and a live test subject, and the machine will destroy the corpse to replace one of the test subject's organs with a brand new mutant set. Enough mutant organs from the same type will make you a proper mutant of that type, possibly changing your species or conveying other positive or negative effects!

Mutant Type Animals with Matching DNA Possible Mutant Organs Organs Required for Set Bonus Set Bonus
Rejected Any not listed here Fly eyes, proboscis, fly heart, fly lungs,fly liver, fly stomach, fly appendix. 4 Turns you into a fully fledged flyperson, like you can become from messing up teleportation. Why the hell would you want to do this?
Carp Space carp Carp lungs (Let you breathe in space but NOT on station),

Carp jaws (Stronger bites and can drop carp teeth, but can't wear anything in mask slot),

Carp brain (On a timer, gives you a negative moodlet advising you to 'go exploring', IE travel to a different Z-level),

Carp heart.

4 Allows you to move freely through space, like a carp can!
Rat Rodents Rat eyes (light sensitive but have night vision),

rat stomach, rat heart, rat tongue.

4 Gain the ability to crawl through station ventilation, as long as your clothes don't get in the way.
Goliath Goliaths Goliath eyes (night vision),

goliath lungs (lets you breathe on lavaland but NOT on station),

goliath brain (no gloves but one of your arms becomes a

tendril hammer),

goliath heart (makes you immune to ash storms.)

4 Makes you immune to lava.
Cat Cat Cat ears, cat tail. N/A You're part cat now, just like in those cartoons with those girls you like so much.
Fox Fox Fox ears. N/A You have fox ears, just like that girl on that poster you keep on your wall.

Scanner.gifMedcom.gifClone.gif Cloning

Cloning was removed from the game in Jan, 2020. This is only for historical reference.

Expand for the old guide to cloning.

For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.

  1. First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
  2. On to the specifics! How to clone: Just grab or pull a body and stuff it into the DNA Scanner and close the door. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
    This is the cloning console menu.
  3. When the Scanner is occupied, interact with the Cloning Console. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the section about cloning errors for details.
  4. If scanning is successful, you will get a Successful Scan -message. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail.
    This is what you see after clicking "View Records".
  5. After you actually have DNA data from a person, click Check Records, and then click View Record of the person who you want to clone. You will see a list of their UI(Unique Identifiers) and their SEs (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). Click Clone. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse inside a body bag in the morgue. You don't have to worry about the old corpse anymore.
    This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load UE, UI and SE (dormant mutations) to and from that disk.
  6. The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their belongings and stuff them all into a locker, so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
    • Aborted cloning: Use this as traitor to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
  7. The cloned people often have cellular damage. If so, take them to cryo to fix it.
  8. After the pod is empty, feel free to clone your next patient, and to let the old one out, since they most likely don't have clearance to open the door.
  9. If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.

OH GOD OH FUCK Hark! A Husk!

So you've come across a husk (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!

  1. First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says Subject no longer contains the fundamental materials required to create a living clone, then you have yourself a husk (if your DNA Scanner had been updated to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
  2. Take the body down to Surgery.
  3. Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
  4. Put the brain in the DNA scanner like you would a body.

Optionally a husk can be unhusked with rezadone. If all goes well then your cadaver will be reborn.

Changeling Victims

If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a changeling. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.

Helping the Headless

Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!

  1. If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with R and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
  2. If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
  3. If you have neither, he's dead for good.

Cloning Plasmamen

If the patient is a plasmaman, cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.

  1. Put plasmaman into cloning scanner
  2. Scan them, start the cloning process
  3. Drag their dead body to cloning pod
  4. Undress them and leave their clothes in a pile
  5. Turn on shower near cloning pod
  6. Once they pop out of cloner, put them under shower and wait for them to dress up

If the patient is a naked or beheaded plasmaman, follow these additional steps:

  1. Once they pop out of cloner, put them under shower and feed them a few Salbutamol pills (if available), or if desperate, keep a syringe of Perfluorodecalin ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
  2. Yell at cargo to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.

Empty Cloning

Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.

Cloning Errors

Error message Cause Solution
Unable to locate valid genetic data. Whatever you put inside the scanner doesn't have valid (humanoid) DNA. Stop putting bees in the scanner.
Subject's brain is not responding to scanning stimuli. The person inside has suicided or signed an infernal contract. Cloning is impossible. Let the Cook take care of them or put the body in the morgue.
Subject no longer contains the fundamental materials required to create a living clone. You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module. Remove the brain and scan it. Yell at RnD to upgrade your scanner.
Mental interface failure. The corpse has no ghost associated with it. Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the Cook handle it.
Subject already in database. That person has already been scanned. Start the cloning process. Want to update the current clone scan? The CMO can delete scan files.
Initialisation failure. The patient is still alive. Try again when the patient is dead.
Unable to initiate cloning cycle. Cloning has been disabled in the server config. Yell at admins and hand the corpse over to the Chef.
Corpse has no head. Some asshole decapitated your guy - clone scanning is impossible without a brain. Draw a blood sample and ask Botany to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck.

Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.

The Gene Genie - The Traitorous Geneticist

Sorry for the bad chapter title. I wanted to use that for a very long time.

So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.

Revolutionary

If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.

Traitor

Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.

If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.

If you have to kill someone, same stuff from rev.

Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.

Changeling

You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect.

Returning to Monke

If you're looking for combat or stealth bonuses, you may use Monkified to get the monkeys', as well as several useful mutations (e.g., Telekinesis, Shock Touch, Chameleon, Gigantism and Dwarfism). Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the Xenobiologist's slime transformation).

Alternatively, there are gorillas. Since the radiation modernization changes (Oct, 2021), you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists.

Given their status as a simplemob, gorillas are immune to wounds and most chemicals—essentially the Hulk's weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls.

  • Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas.

The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit).

To transform a monkey into a gorilla, you have two options:

  • Genetic bombing: once above 2500 genetic damage, monkeys have a 25% chance per second to transform.
  • Mind-Magnification Helmets: when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla.

Additionally, the Traitor geneticist's uplink offers Gorilla Cubes and an autoinjector turning them into a gorilla.